Java Interface for miRanda (JIM) Documentation


Introduction to JIM

JIM is a user friendly graphical user interface for miRanda. JIM is a tool used for microRNA target prediction analysis. Further, JIM extends the prediction results to identify conserved and common targets for a pair of organisms. For requirements of JIM, please see the requirements page.

JIM has the following main components:
1. Run miRanda component
2. Analysis component
3. Displaying miRNA Targets 
The following is the main view of JIM. You can choose Work with miRanda tab to configure and run miRanada (This is default mode), and by choosing JIM Analysis you can analyze the results of the miRanda scan.
picture
JIM MenuBar

JIM’s main menu bar contains ConsoleAction and Help menu items.
The Help menu contains a link to JIM documentation.
Using the Action menu, you can set the directory for JIM input and output files. Once the data path is set, when you click the choose file or save as buttons, you will be directed to this directory (rather than having to browse every time). Similarly, user can set miRanda path and MUSCLE path (if MUSCLE is performed locally).
picture

 

JIM Run miRanada Component

JIM provides users with a user friendly GUI to configure and run miRanada. Users have to be in Work with miRanda tab to run miRanda. JIM runs miRanda scans over two organisms, for example Human and Mouse reference sequences. miRanda predicts which Human/Mouse sequences are potential hits for the microRNA query sequences that are provided in Query miRNA File.

To run miRanda, users need to provide the following files:
Query miRNA file,
Organism 1 Reference file,
Organism 2 Reference file,
output file for hits recevied from Organism 1 reference,
output file for hits recevied from Organism 2 reference, and
Homolog file (Optional at this step. Required during analysis step).
Users can browse and select the files of interest by clicking on Choose File.. button.

To learn more about these files or to download demo files, click here.

picture
If any of the files are not entered, then JIM will fail to run miRanda. It is the users responsibilty to feed in correctly formatted files.

Run miRanada Button

This is used to initiate a new miRanda scan using the query sequences that are provided in Query miRNA File against the organism reference files. Before running miRanada, users can set miRanada parameters by choosing the “Parameters” button. Once the miRanda scan is initiated users can check the miRanda job status, job info, or choose to stop the current miRanda scan.
Job Status Button

Gives the status of Running jobs if any.

picture
Job Info Button

Displays list of all the query sequences. Displays the number of sequences in both reference files.

picture

Parameters Button

Users can view and change miRanada parameters values by choosing this button. If user makes a invalid entry, the value will be reverted back to the default value.

picture

Stop Button

Stops miRanda scan, if there is one being performed.

 

JIM AnalysisComponent

JIM facilitates analysis of targets hits for any number of query sequences. However, we suggest a limit of two query sequences for the current version of JIM and for ease in understanding and interpretting the analysis results. Click here if you want to skip to Results section .

miRNA Target Prediction Analysis Using JIM

Users can choose either a miRanada output or a JIM formatted output to parse and display the miRanada hit results. If this is the first time the query and reference files have been used in JIM, choose “using miRanda output”. (JIM formatted files are generated after analyzing the results and are used to speed up the parsing when results are viewed subsuquent times).

 

Configuring Analysis Environment

The JIM Analysis Wizard guides users to chose the necessary files to set up the analysis. The user must first select the file type to work with: using miRanda output files or JIM formatted files. Begin the analysis by selecting the files requested in the first “Setting up Analysis Environment” window. If you just completed a miRanda scan, the files will be automatically filled from the Run miRanda tab.

 

Selecting miRNAs for Analysis

JIM facilitates analysis of one or two miRNA query sequences. Query files can have multiple miRNA sequences, however, a maximum of two may be selected. Select the one or two miRNAs that you wish to analyze.

 

Select Data Groups to View (1 miRNA selected)

Data from a single miRNA query against two organisms is separated into three groups. Choose the group you want to view by clicking in the box and select add. Additional groups can be added one at a time. Next choose whether you want organism 1 or 2 in the top table when presented in the subsequent display tables.

 

Select Data Groups to View (2 miRNA selected)

Data from a two miRNA query against two organisms is separated into nine groups. Choose the group you want to view by clicking in the box and select add.

Additional groups can be added one at a time. Next choose whether you want organism 1 or 2 in the top table when presented in the subsequent display tables.

 

Display miRNA Prediction Analysis Results

JIM Results Panel

Results are displayed in a table with two panels. Each column can be sorted by clicking on the heading, and width can be changed by dragging the column junctions. The results for the reference miRNA query scanned against Organism 1are displayed in the top panel. The bottom panel displays the rest of the results, which differ depending on what you chose when setting up the Analysis Environment.

  • If only the same query miRNA was selected in the Reference Target Analysis window, the bottom panel displays the results of the reference miRNA query scan against Organism 2.
  • If a different query miRNA was selected in the Reference Target Analysis window, the bottom panel displays the results of the second miRNA scanned against both Organism 1 and Organism 2.
  • If two query miRNA were selected in the Reference Target Analysis window, the bottom panel displays the results of the reference miRNA query scan against Organism 2 AND the results of the second miRNA scanned against bothOrganism 1 and Organism 2 .

picture

 

Compare Results

Click on the Compare Hits button to compare the predicted targets of the reference miRNA query in Organism 1 to predicted targets in Organism 2 and/or predicted targets of the second miRNA query in Organisms 1 and 2. Highlighting is used to indicate conserved or common hits. In the bottom panel, the entry is highlighted to indicate its relationship to an entry in the top panel. In the top panel, coloured tiles are used in the right-hand columns to indicate the relationship of a predicted target to one or more entry in the bottom panel.

 

picture

The figure below shows how the different overlaping datasets are highlighted.

 

picture

For example, a predicted target in the top panel with a green and a red tile means that the reference miRNA query hits a target in Organism 1 AND its homolog in Organism 2 (Green) and that the second query miRNA also hits same target and homolog (red).

Show Conserved Only and Show All buttons — Clicking the Show Conserved Only button (active after Compare Hits is used) will display only highlighted entries. Show All will display all results, highlighed and unhighlighted.

Sort by Highlight button
(Active only after using Compare Hits) Will sort results according to their highlighting.
Base-By-Base button
Select two or more entries and click this button to generate an alignment of the target sequences. The sequences are aligned using MUSCLE in the program Base-By-Base (BBB), an alignment editor designed at the VBRC. BBB will launch automatically when this is selected. See BBB for more info on this alignment editor.

Link to Ensembl database

To get more information about a specific target, you can link to the Ensemble database by selecting the sequence and then choose Ensembl Link under the Action menu. The gene specific entry in the Ensembl database will open in your default web browser.

picture

 

Target Statistics

The total number of hits for each selcted miRNA:Target Organism pair can be displayed by choosing Total Hits under the Action menu.

picture

 

Saving Results

There are multiple ways to save results: saving IDs, saving selected entries for export to a spreadsheet, or saving as a JIM formatted file. These options are found under the File menu.

picture

JIM Files

  • Results can be saved as a JIM file, which can be opened from the JIM Analysis tab next time you use JIM. JIM files are smaller and will open more quickly than miRanda output files, so it is recommended that results are saved in this more convenient format if you plan on viewing the data again. A separate JIM file is made for each organism. Enter the desired filename and directory, and the organism name if desired. JIM files can also be saved by clicking on theSave to JIM files button at the bottom of the JIM Results window.

picture

Saving gene IDs

  • The IDs of the predicted targets can be saved to a file, which may be useful for use in other programs or any downstream analysis of the targets. Select the desired dataset and the IDs to be saved.

picture

 

Overview of all Files

Input Files for JIM

JIM requires appropriately formatted input files for running miRanda and comparing the results from two different organisms:

1. A FASTA format file containing one or more query miRNA sequences:

>hsa-miR-379
TGGTAGACTATGGAACGTA
>hsa-miR-299-5p
TGGTTTACCGTCCCACATACAT

2. Two FASTA format reference files containing the sequences to be scanned (one for each organism) with header information that can be parsed appropriately into the columns in the JIM analysis tables/

>ENSG00000131584|Centaurin-beta 5 (Cnt-b5). [Source:Uniprot/SWISSPROT;Acc:Q96P50]|ENST00000354700 GGCCGGGCAGGCCGGGCAGCTGCCACCCCGCCCGGCCCGACGCCCCGCATGCCCCGAAGTCCCTGGCGCCCACCCGGCCG CGGCCCTGCGTGTGACCCGCGGGTCGATACCTGGCAGCCCCAGTGCTGGGGCGCCGCGGCCCTGCTCGCCCAGGAGGAGA

3. A file listing the genes from each organism and their respective homolog.

Ensembl Gene ID,Mouse Ensembl Gene ID
ENSG00000198804,ENSMUSG00000064351.1
ENSG00000198695,ENSMUSG00000064368.1
ENSG00000136319,ENSMUSG00000006288.3

JIM supports analysis only for files that are extracted from ENSEMBL database or are organized in an identical manner.  Although the number of query miRNA sequences in the query file is unlimited, for the current version of JIM we recommend 2 query sequences.

Currently JIM recognizes the Ensembl IDs for the following organisms, and will automatically enter the organism name in the analysis tables:

HUMAN — ENSG like Ensembl IDs
MOUSE — ENSMUSG like Ensembl IDs
CHIMPANZEE — ENSPTRG like Ensembl IDs
MONKEY — ENSMMUG like Ensembl IDs
ZEBRAFISH — ENSDARG like Ensembl IDs
CHICKEN — ENSGALG like Ensembl IDs
DROSOPHILLA — CG like Ensembl IDs
DOG — ENSCAFG like Ensembl IDs
CATTLE — ENSBTAG like Ensembl IDs

If the user enters any other organism, they will be simply named organism “ONE” or “TWO”.

 

Jim Organism Reference File

How to Make a JIM Organism Reference File :

How to make an organism reference file:

1. Choose database with drop down menu (Ensembl 52)

2. Choose the organism with the drop down menu that appears (Homo sapiens NCBI36)

3. At the left, click Attributes,
4. Select the Sequences Radio button
5.Expand the SEQUENCES section.
6. Select 3’UTR

7. Expand the HEADER section 8. Select Ensembl gene ID, Ensembl Transcript ID and Description

9. Click on Results at the top left and download the results.

 

Jim Homologs File

How to make a Jim Homolog File :

How to make a homolog file:

Steps 1 and 2; The same as for a Jim Organism Reference File (above).

3. Click on Attributes
4. Select homologs redio button
5. Expand GENE section
6. Select Ensembl gene ID

7. Scroll down to MOUSE ORTHOLOGS 8. Select Mouse Ensembl Gene ID

9. Click on Results at the top left and download the results.

 

JIM Requirements

Requirements for JIM

To run JIM, web based clients (users) need to have Java Webstart (JWS) and J2SE 1.5 or higher installed on their local machine. JWS usually comes with JRE.

JIM is built on miRanda, an open source project developed at Memorial Sloan-Kettering Cancer Center. miRanda does not come packaged with JIM, it must be installed independently. miRanda software can be found here.

JIM also requires MUSCLE alignment software to align selected miRNA hits in Base-By-Base (an alignment editor developed at the VBRC). Alternatively you may choose to run MUSCLE remotely on our VBRC servers. Click here for MUSCLE.

Tagged with:
 

Comments are closed.